mrt-2

Feedback

External Links

Variants

CHROM:POS (REF/ALT) Feature ID Biotype Effect AA Change Impact
III:11746784 (TCG / T) Y41C4A.14.1 protein_coding 5_prime_UTR_variant MODIFIER
III:11746796 (G / C) Y41C4A.14.1 protein_coding 5_prime_UTR_variant MODIFIER
III:11746835 (G / A) Y41C4A.14.1 protein_coding 5_prime_UTR_variant MODIFIER
III:11746865 (C / A) Y41C4A.14.1 protein_coding 5_prime_UTR_variant MODIFIER
III:11746890 (A / T) Y41C4A.14.1 protein_coding 5_prime_UTR_variant MODIFIER
III:11746891 (T / C) Y41C4A.14.1 protein_coding 5_prime_UTR_variant MODIFIER
III:11746894 (CCGCG / C) Y41C4A.14.1 protein_coding 5_prime_UTR_variant MODIFIER
III:11746907 (A / G) Y41C4A.14.1 protein_coding 5_prime_UTR_variant MODIFIER
III:11746964 (T / C) Y41C4A.14.1 protein_coding splice_donor_variant
intron_variant
HIGH
III:11746978 (T / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747020 (C / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747047 (A / G) Y41C4A.14.1 protein_coding 5_prime_UTR_variant MODIFIER
III:11747047 (A / G) Y41C4A.14.2 protein_coding 5_prime_UTR_variant MODIFIER
III:11747051 (G / A) Y41C4A.14.1 protein_coding start_lost p.Met1? HIGH
III:11747051 (G / A) Y41C4A.14.2 protein_coding start_lost p.Met1? HIGH
III:11747179 (A / AT) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747179 (A / AT) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747199 (TA / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747199 (TA / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747202 (AT / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747202 (AT / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747226 (C / T) Y41C4A.14.1 protein_coding missense_variant p.Thr36Met MODERATE
III:11747226 (C / T) Y41C4A.14.2 protein_coding missense_variant p.Thr36Met MODERATE
III:11747231 (C / T) Y41C4A.14.1 protein_coding missense_variant p.His38Tyr MODERATE
III:11747231 (C / T) Y41C4A.14.2 protein_coding missense_variant p.His38Tyr MODERATE
III:11747254 (G / A) Y41C4A.14.1 protein_coding synonymous_variant p.Lys45Lys LOW
III:11747254 (G / A) Y41C4A.14.2 protein_coding synonymous_variant p.Lys45Lys LOW
III:11747281 (G / A) Y41C4A.14.1 protein_coding synonymous_variant p.Gln54Gln LOW
III:11747281 (G / A) Y41C4A.14.2 protein_coding synonymous_variant p.Gln54Gln LOW
III:11747287 (C / A) Y41C4A.14.1 protein_coding synonymous_variant p.Ala56Ala LOW
III:11747287 (C / A) Y41C4A.14.2 protein_coding synonymous_variant p.Ala56Ala LOW
III:11747340 (T / A) Y41C4A.14.1 protein_coding missense_variant p.Ile74Lys MODERATE
III:11747340 (T / A) Y41C4A.14.2 protein_coding missense_variant p.Ile74Lys MODERATE
III:11747346 (C / T) Y41C4A.14.1 protein_coding missense_variant p.Ser76Leu MODERATE
III:11747346 (C / T) Y41C4A.14.2 protein_coding missense_variant p.Ser76Leu MODERATE
III:11747362 (T / A) Y41C4A.14.1 protein_coding synonymous_variant p.Ile81Ile LOW
III:11747362 (T / A) Y41C4A.14.2 protein_coding synonymous_variant p.Ile81Ile LOW
III:11747401 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747401 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747402 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747402 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747410 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747410 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747426 (A / C) Y41C4A.14.1 protein_coding splice_region_variant
intron_variant
LOW
III:11747426 (A / C) Y41C4A.14.2 protein_coding splice_region_variant
intron_variant
LOW
III:11747442 (G / C) Y41C4A.14.1 protein_coding synonymous_variant p.Leu88Leu LOW
III:11747442 (G / C) Y41C4A.14.2 protein_coding synonymous_variant p.Leu88Leu LOW
III:11747646 (C / T) Y41C4A.14.1 protein_coding synonymous_variant p.Asp140Asp LOW
III:11747646 (C / T) Y41C4A.14.2 protein_coding synonymous_variant p.Asp140Asp LOW
III:11747698 (A / G) Y41C4A.14.1 protein_coding missense_variant p.Ile158Val MODERATE
III:11747698 (A / G) Y41C4A.14.2 protein_coding missense_variant p.Ile158Val MODERATE
III:11747738 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747738 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747749 (CTCCAGACATTTTCCAAAAA … / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747749 (CTCCAGACATTTTCCAAAAA … / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747816 (T / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747816 (T / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747820 (T / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747820 (T / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747839 (CT / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747839 (CT / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747856 (C / CA) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747856 (C / CA) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747866 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747866 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747877 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747877 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747921 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747921 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747924 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747924 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747925 (T / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747925 (T / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747941 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747941 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747965 (G / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747965 (G / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747984 (TA / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747984 (TA / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11747999 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11747999 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748009 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748009 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748011 (C / CG) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748011 (C / CG) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748013 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748013 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748038 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748038 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748044 (AT / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748044 (AT / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748048 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748048 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748059 (T / TC) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748059 (T / TC) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748065 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748065 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748075 (ATTTCTGAAAAAATTAGCT / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748075 (ATTTCTGAAAAAATTAGCT / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748099 (GA / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748099 (GA / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748107 (AAC / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748107 (AAC / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748126 (T / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748126 (T / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748148 (AAAATCGGTTTCCCTTCAGA … / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748148 (AAAATCGGTTTCCCTTCAGA … / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748172 (T / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748172 (T / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748173 (ATTGTTTTTGGGTTTTTTCC … / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748173 (ATTGTTTTTGGGTTTTTTCC … / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748264 (G / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748264 (G / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748294 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748294 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748312 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748312 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748321 (G / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748321 (G / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748322 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748322 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748323 (G / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748323 (G / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748367 (C / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748367 (C / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748368 (G / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748368 (G / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748375 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748375 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748377 (T / TA) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748377 (T / TA) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748379 (A / AC) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748379 (A / AC) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748383 (T / TTTG) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748383 (T / TTTG) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748386 (G / GAAAAACGTT) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748386 (G / GAAAAACGTT) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748389 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748389 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748390 (CTT / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748390 (CTT / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748394 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748394 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748413 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748413 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748417 (G / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748417 (G / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748422 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748422 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748423 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748423 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748426 (T / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748426 (T / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748430 (A / ACAGATTTTCGACTTTT) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748430 (A / ACAGATTTTCGACTTTT) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748446 (TGG / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748446 (TGG / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748469 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748469 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748525 (T / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748525 (T / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748526 (CCG / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748526 (CCG / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748540 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748540 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748547 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748547 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748560 (G / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748560 (G / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748569 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748569 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748574 (T / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748574 (T / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748578 (A / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748578 (A / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748586 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748586 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748588 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748588 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748598 (AAAAT / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748598 (AAAAT / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748604 (C / CA) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748604 (C / CA) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748607 (A / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748607 (A / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748609 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748609 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748616 (C / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748616 (C / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748621 (T / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748621 (T / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748626 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748626 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748670 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748670 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748690 (C / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748690 (C / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748696 (AAGT / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748696 (AAGT / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748728 (TA / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748728 (TA / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748744 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748744 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748749 (G / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748749 (G / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748762 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748762 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748784 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748784 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748786 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748786 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748788 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748788 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748807 (C / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748807 (C / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748843 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748843 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748844 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748844 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748864 (T / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748864 (T / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11748896 (A / G) Y41C4A.14.1 protein_coding missense_variant p.Asp163Gly MODERATE
III:11748896 (A / G) Y41C4A.14.2 protein_coding missense_variant p.Asp163Gly MODERATE
III:11748969 (G / A) Y41C4A.14.1 protein_coding synonymous_variant p.Glu187Glu LOW
III:11748969 (G / A) Y41C4A.14.2 protein_coding synonymous_variant p.Glu187Glu LOW
III:11748997 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11748997 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749023 (AGAAAAAAATTTTAATTTTT … / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749023 (AGAAAAAAATTTTAATTTTT … / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749089 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749089 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749095 (T / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749095 (T / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749208 (A / G) Y41C4A.14.1 protein_coding synonymous_variant p.Gln218Gln LOW
III:11749208 (A / G) Y41C4A.14.2 protein_coding synonymous_variant p.Gln218Gln LOW
III:11749236 (A / G) Y41C4A.14.1 protein_coding missense_variant p.Thr228Ala MODERATE
III:11749236 (A / G) Y41C4A.14.2 protein_coding missense_variant p.Thr228Ala MODERATE
III:11749255 (AG / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749255 (AG / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749288 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749288 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749335 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749335 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749340 (G / GA) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749340 (G / GA) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749342 (GA / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749342 (GA / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749344 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749344 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749357 (T / TTCTTTTAAAAAATTCATTT …) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749357 (T / TTCTTTTAAAAAATTCATTT …) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749361 (G / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749361 (G / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749371 (GA / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749371 (GA / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749387 (A / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749387 (A / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749424 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749424 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749438 (A / AT) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749438 (A / AT) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749452 (A / AT) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749452 (A / AT) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749454 (A / AATTTATTTTTAAAAAAATT …) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749454 (A / AATTTATTTTTAAAAAAATT …) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749460 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749460 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749465 (T / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749465 (T / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749473 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749473 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749474 (T / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749474 (T / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749475 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749475 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749482 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749482 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749489 (A / ATTTTTTTCGATTCGAT) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749489 (A / ATTTTTTTCGATTCGAT) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749506 (G / GA) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749506 (G / GA) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749510 (AT / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749510 (AT / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749518 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749518 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749519 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749519 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749530 (A / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749530 (A / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749533 (AATTTTC / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749533 (AATTTTC / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749558 (GA / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749558 (GA / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749583 (AAAATGTCT / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749583 (AAAATGTCT / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749597 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749597 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749599 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749599 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749600 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749600 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749607 (AT / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749607 (AT / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749620 (T / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749620 (T / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749633 (A / ATC) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749633 (A / ATC) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749647 (GT / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749647 (GT / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749655 (C / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749655 (C / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749658 (CGAAAAAAAACCCCAAAAAC … / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749658 (CGAAAAAAAACCCCAAAAAC … / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749752 (G / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749752 (G / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749761 (T / A) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749761 (T / A) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749769 (A / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749769 (A / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749770 (A / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749770 (A / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749772 (G / T) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749772 (G / T) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749782 (G / GA) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749782 (G / GA) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749816 (CTCGAA / C) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749816 (CTCGAA / C) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749835 (A / G) Y41C4A.14.1 protein_coding intron_variant MODIFIER
III:11749835 (A / G) Y41C4A.14.2 protein_coding intron_variant MODIFIER
III:11749865 (C / T) Y41C4A.14.1 protein_coding synonymous_variant p.Ile231Ile LOW
III:11749865 (C / T) Y41C4A.14.2 protein_coding synonymous_variant p.Ile231Ile LOW
III:11749868 (C / T) Y41C4A.14.1 protein_coding synonymous_variant p.Leu232Leu LOW
III:11749868 (C / T) Y41C4A.14.2 protein_coding synonymous_variant p.Leu232Leu LOW
III:11749950 (A / T) Y41C4A.14.1 protein_coding missense_variant p.Thr260Ser MODERATE
III:11749950 (A / T) Y41C4A.14.2 protein_coding missense_variant p.Thr260Ser MODERATE
III:11749971 (G / T) Y41C4A.14.1 protein_coding stop_gained p.Glu267* HIGH
III:11749971 (G / T) Y41C4A.14.2 protein_coding stop_gained p.Glu267* HIGH
III:11749974 (T / A) Y41C4A.14.1 protein_coding stop_lost p.Ter268Lysext*? HIGH
III:11749974 (T / A) Y41C4A.14.2 protein_coding stop_lost p.Ter268Lysext*? HIGH
III:11750004 (T / A) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750004 (T / A) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750005 (T / A) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750005 (T / A) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750009 (G / T) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750009 (G / T) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750012 (C / T) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750012 (C / T) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750014 (A / T) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750014 (A / T) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750026 (T / C) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750026 (T / C) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750047 (T / A) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750047 (T / A) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750060 (A / T) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750060 (A / T) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750062 (C / T) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750062 (C / T) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750074 (C / T) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750074 (C / T) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750098 (T / G) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750098 (T / G) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750109 (TC / T) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750109 (TC / T) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750115 (TCGTGCTTCTTGCAATTCTC … / T) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750115 (TCGTGCTTCTTGCAATTCTC … / T) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750159 (A / T) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750159 (A / T) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER
III:11750170 (T / C) Y41C4A.14.1 protein_coding 3_prime_UTR_variant MODIFIER
III:11750170 (T / C) Y41C4A.14.2 protein_coding 3_prime_UTR_variant MODIFIER

Gene Ontology

Type ID Label

Phenotypes

Phenotype Evidence