mrt-2

Feedback

External Links

Variants

CHROM:POS (REF/ALT) Feature ID Biotype Effect AA Change Impact
III:11747051 (G / A) Y41C4A.14 protein_coding start_lost p.Met1? HIGH
III:11747179 (A / AT) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747199 (TA / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747202 (AT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747203 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747226 (C / T) Y41C4A.14 protein_coding missense_variant p.Thr36Met MODERATE
III:11747231 (C / T) Y41C4A.14 protein_coding missense_variant p.His38Tyr MODERATE
III:11747281 (G / A) Y41C4A.14 protein_coding synonymous_variant p.Gln54Gln LOW
III:11747287 (C / A) Y41C4A.14 protein_coding synonymous_variant p.Ala56Ala LOW
III:11747340 (T / A) Y41C4A.14 protein_coding missense_variant p.Ile74Lys MODERATE
III:11747346 (C / T) Y41C4A.14 protein_coding missense_variant p.Ser76Leu MODERATE
III:11747401 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747410 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747426 (A / C) Y41C4A.14 protein_coding splice_region_variant
intron_variant
LOW
III:11747601 (AT / A/ATT) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747601 (AT / A/ATT) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747646 (C / T) Y41C4A.14 protein_coding synonymous_variant p.Asp140Asp LOW
III:11747738 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747739 (A / G/T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747739 (A / G/T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747750 (TCCAG / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747751 (CCAGA / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747770 (A / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747771 (AT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747772 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747773 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747799 (TG / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747800 (GT / GTT/G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747800 (GT / GTT/G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747816 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747820 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747827 (CT / C/CTT) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747827 (CT / C/CTT) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747839 (CT / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747849 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747856 (C / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747856 (C / CA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747866 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747877 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747898 (GT / GTTT/GTT/G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747898 (GT / GTTT/GTT/G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747898 (GT / GTTT/GTT/G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747899 (T / TTA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747921 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747925 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747928 (A / AT) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747930 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747941 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747948 (GA / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747955 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747955 (AT / ATT/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747955 (AT / ATT/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747956 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747965 (G / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747984 (TA / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11747999 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748009 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748011 (C / CG) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748017 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748017 (A / AT) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748038 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748048 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748060 (C / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748065 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748066 (CA / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748067 (A / AAAAAATTTTT) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748075 (ATTTCTGAAAAAATTAGCT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748079 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748081 (GA / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748090 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748091 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748099 (GA / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748110 (CA / CTA/C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748110 (CA / CTA/C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748111 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748116 (TTTTTAAA / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748118 (T / TA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748119 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748119 (T / TA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748120 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748120 (TA / TTTAGTCGAAAAACA/T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748120 (TA / TTTAGTCGAAAAACA/T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748121 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748133 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748141 (GA / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748150 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748182 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748205 (C / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748222 (C / CG) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748231 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748233 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748239 (TG / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748240 (GA / G/GAAAAAAAAAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748240 (GA / G/GAAAAAAAAAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748248 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748248 (AT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748249 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748259 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748259 (TTTC / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748264 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748294 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748312 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748321 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748322 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748323 (G / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748335 (C / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748343 (GT / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748354 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748355 (TG / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748356 (GA / G/GAA/GAAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748356 (GA / G/GAA/GAAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748356 (GA / G/GAA/GAAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748367 (C / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748368 (G / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748375 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748377 (TTATTTTTCG / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748396 (T / TTC/TC) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748396 (T / TTC/TC) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748406 (CG / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748407 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748413 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748417 (G / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748448 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748469 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748470 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748478 (G / GA/GAAAAAAAATTTTTTTCGAATTTTTTGCAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748478 (G / GA/GAAAAAAAATTTTTTTCGAATTTTTTGCAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748483 (A / AAATTTTTTTTCGAATTTTTTGCAAAAAAT) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748485 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748485 (ATT / AT/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748485 (ATT / AT/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748486 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748488 (T / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748513 (TC / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748514 (CA / CAA/C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748514 (CA / CAA/C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748538 (G / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748538 (G / GA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748539 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748540 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748569 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748574 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748579 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748586 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748591 (CA / C/CAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748591 (CA / C/CAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748607 (A / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748609 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748616 (C / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748621 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748622 (G / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748626 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748655 (TG / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748657 (GA / G/GAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748657 (GA / G/GAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748690 (C / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748696 (AAGT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748697 (AGT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748701 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748709 (T / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748728 (TA / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748744 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748749 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748770 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748784 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748786 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748788 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748807 (C / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748843 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748844 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748846 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748846 (T / TA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748864 (T / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748866 (AT / ATT/ATTT/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748866 (AT / ATT/ATTT/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748866 (AT / ATT/ATTT/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748867 (T / TTA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748871 (T / TTA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748874 (TC / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11748969 (G / A) Y41C4A.14 protein_coding synonymous_variant p.Glu187Glu LOW
III:11748997 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749031 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749031 (AT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749045 (ACT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749047 (TCAAA / TAA/TA/T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749047 (TCAAA / TAA/TA/T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749047 (TCAAA / TAA/TA/T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749048 (CAAAAAAAAA / CAAAAA/C/CAAAAAAA/CAAAAAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749048 (CAAAAAAAAA / CAAAAA/C/CAAAAAAA/CAAAAAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749048 (CAAAAAAAAA / CAAAAA/C/CAAAAAAA/CAAAAAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749048 (CAAAAAAAAA / CAAAAA/C/CAAAAAAA/CAAAAAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749053 (AAAAAAAAAAAAAATTGTTTTGAAAAAATATTTTTT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749057 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749058 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749058 (AAAAAAAAAT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749059 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749060 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749063 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749063 (AAAAT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749064 (AAAT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749065 (AATT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749066 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749069 (G / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749085 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749086 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749087 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749088 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749089 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749095 (T / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749141 (G / T) Y41C4A.14 protein_coding missense_variant p.Ser196Ile MODERATE
III:11749208 (A / G) Y41C4A.14 protein_coding synonymous_variant p.Gln218Gln LOW
III:11749288 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749335 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749337 (T / TG) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749341 (G / T/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749341 (G / T/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749342 (GA / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749343 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749352 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749352 (AT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749353 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749370 (TG / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749371 (GA / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749387 (A / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749438 (A / AT) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749447 (G / GAAAAATTAATTTATTTTTAA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749454 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749457 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749460 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749464 (G / T/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749464 (G / T/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749465 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749466 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749473 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749474 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749475 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749482 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749489 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749494 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749498 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749506 (G / GA) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749510 (AT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749511 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749518 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749530 (A / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749534 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749534 (AT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749535 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749538 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749539 (C / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749540 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749540 (AT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749558 (GA / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749583 (AAAATGTCT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749587 (TGTCTAAAG / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749597 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749600 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749607 (AT / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749625 (CAA / CA/C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749625 (CAA / CA/C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749633 (A / ATC) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749655 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749665 (A / G) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749687 (G / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749690 (C / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749690 (CA / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749701 (A / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749712 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749716 (C / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749743 (T / C) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749752 (G / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749761 (T / A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749770 (A / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749772 (G / T) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749785 (AT / ATT/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749785 (AT / ATT/A) Y41C4A.14 protein_coding intron_variant MODIFIER
III:11749865 (C / T) Y41C4A.14 protein_coding synonymous_variant p.Ile231Ile LOW
III:11749868 (C / T) Y41C4A.14 protein_coding synonymous_variant p.Leu232Leu LOW
III:11749950 (A / T) Y41C4A.14 protein_coding missense_variant p.Thr260Ser MODERATE
III:11749971 (G / T) Y41C4A.14 protein_coding stop_gained p.Glu267* HIGH
III:11749974 (T / A) Y41C4A.14 protein_coding stop_lost p.Ter268Lysext*? HIGH
III:11750005 (T / A) Y41C4A.14 protein_coding 3_prime_UTR_variant MODIFIER
III:11750012 (C / T) Y41C4A.14 protein_coding 3_prime_UTR_variant MODIFIER
III:11750014 (A / T) Y41C4A.14 protein_coding 3_prime_UTR_variant MODIFIER
III:11750047 (T / A) Y41C4A.14 protein_coding 3_prime_UTR_variant MODIFIER
III:11750088 (CA / C/CAA) Y41C4A.14 protein_coding 3_prime_UTR_variant MODIFIER
III:11750088 (CA / C/CAA) Y41C4A.14 protein_coding 3_prime_UTR_variant MODIFIER
III:11750098 (T / G) Y41C4A.14 protein_coding 3_prime_UTR_variant MODIFIER
III:11750114 (TTCGTGCTTCTTGCAATTCTCGCTGTTGATTTAA / T) Y41C4A.14 protein_coding 3_prime_UTR_variant MODIFIER
III:11750129 (A / T) Y41C4A.14 protein_coding 3_prime_UTR_variant MODIFIER

Gene Ontology

Type ID Label

Phenotypes

Phenotype Evidence